Produkty
Producenci

EGFR L861Q Reference Standard, 50%

nr kat.: HD133
Cena brutto: do wyceny
ilość szt.

towar niedostępny

dodaj do przechowalni

Opis

Synonym: ERBB, ERBB1

Format: FFPE

The EGFR L861Q Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.

With this product you are able to:

• Evaluate of workflow integrity from pre-analytical DNA extraction to post-analytical bioinformatics
• Analyze the sensitivity of your workflow
• Optimize and validate new cancer panels and routinely monitor the performance of your assay


Horizon FFPE standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. The standard is provided at an allelic frequency of 50%, and may be diluted using the corresponding wild type standard to generate a lower allelic frequencies for limit of detection studies and validation of your pre-analytical phase of the workflow.

Horizon’s Base-Seq products are all derived from human cell lines. Using a proprietary method of mild fixation and homogenous paraffin embedding, we generate highly-reproducible and consistent FFPE curls. With any commercially available FFPE extraction protocol, our standards yield high molecular weight DNA. This format ensures that they may applied to a wide-range of assays including qPCR, Sanger sequencing, next-generation sequencing, mass array, and more.

Technical Data

DNA Base Change: CTG→CAG

NCBI Reference Assembly SNP: rs121913444

Cosmic ID: COSM6213

Fixation Method: 4% Formalin

Section Size: 15µm or 20µm

Cell Density: 3 x 108 cells per block. Approx. 3.5 x 105 cells per section

Expected DNA Yield: ≥ 400 ng using Promega Maxwell LEV Plus Extraction kit

Product Information

Intended Use: For routine performance monitoring (Research Use Only)

Unit Size: 1 FFPE Section per vial

Extractable DNA: ≥ 400 ng per section using Promega Maxwell LEV Plus FFPE DNA Extraction kit

General Information

Allelic Frequency: 50%

Storage: 4˚C

Expiry: 48 months from the date of manufacture

Cell Line Background: RKO

Quality Control

Allelic Frequency: Droplet Digital PCR™
Genotype: Sanger sequencing of locus specific PCR
Quality: Agarose gel electrophoresis
Quantification: Quantifluor™
Genotype: EGFR (L861Q/+)

Characterization

Chromatogram

Chromatograph showing heterozygosity for the EGFR L861Q within EGFR exon 21 (SNP accession number: rs121913444)

Primers
    Primer        Sequence                                           Size
    Forward    CATTCATGCGTCTTCACCTG              346
    Reverse    ATCCTCCCCTGCATGTGTTA               346
    Sequencing    CTCAGAGCCTGGCATGAAC    --

do góry
Sklep jest w trybie podglądu
Pokaż pełną wersję strony
Sklep internetowy Shoper.pl