NRAS Wild TypeReference Standard

Synonyms: N-Ras

Format: FFPE

The NRAS Wild TypeReference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.

With this product you are able to:

• Evaluate of workflow integrity from pre-analytical DNA extraction to post-analytical bioinformatics
• Analyze the sensitivity of your workflow
• Optimize and validate new cancer panels and routinely monitor the performance of your assay

Horizon FFPE standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. The standard is provided at an allelic frequency of 50%, and may be diluted using the corresponding wild type standard to generate a lower allelic frequencies for limit of detection studies and validation of your pre-analytical phase of the workflow.

Horizon’s Base-Seq products are all derived from human cell lines. Using a proprietary method of mild fixation and homogenous paraffin embedding, we generate highly-reproducible and consistent FFPE curls. With any commercially available FFPE extraction protocol, our standards yield high molecular weight DNA. This format ensures that they may applied to a wide-range of assays including qPCR, Sanger sequencing, next-generation sequencing, mass array, and more.

Technical Data

Fixation Method: 4% Formalin

Section Size: 15µm or 20µm

Cell Density: 3 x 10⁸ cells per block. Approx. 3.5 x 10⁵ cells per section

Expected DNA Yield: ≥ 400 ng using Promega Maxwell LEV Plus Extraction kit

Product Information

Intended Use: For routine performance monitoring (Research Use Only)

Unit Size: 1 FFPE Section per vial

Extractable DNA: ≥ 400 ng per section using Promega Maxwell LEV Plus FFPE DNA Extraction kit

General Information

Allelic Frequency: 100%

Storage: 4˚C

Expiry: 48 months from the date of manufacture

Cell Line Background: SW48

Quality Control

Allelic Frequency: Droplet Digital PCR™
Genotype: Sanger sequencing of locus specific PCR
Quality: Agarose gel electrophoresis
Quantification: Quantifluor™
Genotype: NRAS (+/+)

Characterization

Chromatogram: NRAS Wild Type Reference Standard

Chromatograph showing heterozygosity for the N-Ras Q61H mutation within N-Ras

Primers
    Primer        Sequence                                            Size
    Forward    GCTTATTTAACCTTGGCAATAGCA        521
    Reverse    CCAAGTCATTCCCAGTAGCAA             521
    Sequencing    GCTTATTTAACCTTGGCAATAGCA