Producenci
BRAF V600E Reference Standard, 1%
Opis
Synonyms: B-Raf, BRAF1
Forma: FFPE
The BRAF V600E Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.
With this product you are able to:
• Evaluate of workflow integrity from pre-analytical DNA extraction to post-analytical bioinformatics
• Analyze the sensitivity of your workflow
• Optimize and validate new cancer panels and routinely monitor the performance of your assay
Horizon FFPE standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. The standard is provided at an allelic frequency of 1%, and may be diluted using the corresponding wild type standard to generate a lower allelic frequencies for limit of detection studies and validation of your pre-analytical phase of the workflow.
Horizon’s Base-Seq products are all derived from human cell lines. Using a proprietary method of mild fixation and homogenous paraffin embedding, we generate highly-reproducible and consistent FFPE curls. With any commercially available FFPE extraction protocol, our standards yield high molecular weight DNA. This format ensures that they may applied to a wide-range of assays including qPCR, Sanger sequencing, next-generation sequencing, mass array, and more.
Technical Data
DNA Base Change: GTG→GAG
NCBI Reference Assembly SNP: rs113488022
Cosmic ID: COSM476
Fixation Method: 4% Formalin
Section Size: 15µm or 20µm
Cell Density: 3 x 108 cells per block. Approx. 3.5 x 105 cells per section
Expected DNA Yield: ≥ 400 ng using Promega Maxwell LEV Plus Extraction kit
Product Information
Intended Use: For routine performance monitoring (Research Use Only)
Unit Size: 1 FFPE Section per vial
Extractable DNA: ≥ 400 ng per section using Promega Maxwell LEV Plus FFPE DNA Extraction kit
General Information
Allelic Frequency: 1%
Storage: 4˚C
Expiry: 48 months from the date of manufacture
Cell Line Background: SW48
Quality Control
Allelic Frequency: Droplet Digital PCR™
Genotype: Sanger sequencing of locus specific PCR
Quality: Agarose gel electrophoresis
Quantification: Quantifluor™
Genotype: BRAF (V600E/+)
Characterization
BRAF V600E Reference Standard - Chromatogram
Chromatograph showing heterozygosity for the B-Raf V600E mutation within B-Raf exon 15 (SNP accession number: rs113488022)

Primers
Primer Sequence Size
Forward CTGGGCCTACATTGCTAAAAT 513
Reverse AGTTGAGACCTTCAATGACTTTCTA
Sequencing AGTTGAGACCTTCAATGACTTTCTA --